En qué se parece un cromosoma a un paraguas

Vale, el título no es gran cosa. Intenta impactar para luego contar algo muy trivial, así que no te esperes mucho de esta entrada. El título es publicidad baratilla. ¡Yo soy así! 8)

Un cromosoma es algo con lo que, más o menos, la gente está familiarizada. Se ve en las películas o series, sale en la prensa, la gente habla de cromosomas en los bares. Se ha incorporado a la cultura común. Si alguien no sabe que en el núcleo de las células tenemos cromosomas es considerado inculto. Y aún más, la gente sabe que los cromosomas están hechos de ADN. Bastantes también saben que los cromosomas se dividen entre las células hijas.

Cromosomas

Vamos a cargarnos las tres ideas. Porque, sin dejar de ser un poquito ciertas, no son exactas. ¡A por la primera!

1º) Un cromosoma no está en el núcleo.

Por la sencilla razón de que cuando se ven los cromosomas el núcleo ha desaparecido. O está en ello (a lo mejor queda parte de la membrana del núcleo). Porque un cromosoma es una estructura en la que el ADN está muy empaquetado, muy denso, muy apretado y protegido. Es una buena estructura para que el hilo de ADN, siempre frágil, viaje, vaya de un sitio a otro. Si el hilo se moviera, sin apretarse antes, podría romperse. Y el núcleo sería un estorbo, encerraría el hilo, le impediría ir a otro sitio. Siempre que veas cromosomas es que la célula está preparada para reproducirse. Y reproducirse quiere decir repartir el ADN, dividirlo en dos y llevar cada mitad a un extremo quitando de enmedio la membrana del núcleo. Así es como se desplaza el ADN. Bajo la forma de cromosoma. ADN en movimiento.

El núcleo de una célula es un espacio separado del resto. Separado por una membrana que está dispuesta sobre un complejo andamiaje de citoesqueleto (ya sabes, las fibrillas que están dentro de una célula y que le dan forma, o que mueven lo que hay en el interior de un sitio a otro; hecho por proteínas como actina, miosina, tubulina, y otros muchos nombres raros). O sea, que el lugar donde creíamos que estaban los cromosomas no es. ¿Luego es mentira que los cromosomas están en el núcleo? Sí y no.

Los cromosomas no están en el núcleo, pero la sustancia que forma los cromosomas sí. Los cromosomas están hechos de cromatina.

Y aquí es donde te explico el título. Cuando te explico lo que es la cromatina. Imagina la tela del paraguas. Está pegada a las varillas del paraguas. Las varillas se pueden plegar y desplegar. La tela del paraguas es la misma, esté éste abierto o no. Tiene diferente forma, pero es la misma. Igual ocurre con las varillas. Cambian de posición pero no dejan de ser las varillas. Así pasa con la cromatina.

La cromatina es ADN y toda una serie de proteínas que la acompañan. Las proteínas hacen varias cosas, pero una de ellas es plegar y desplegar el ADN. La cromatina es el ADN estirado, abierto. El cromosoma es el ADN plegado, superplegado, enrollado, superenrollado. Sea cromatina o cromosoma, el ADN no deja de ser ADN. Pero en estado de cromatina puede ser leído. Y en estado de cromosoma puede ser movido.

Las proteínas más importantes de ese andamiaje, al que se sujeta el ADN, son las histonas. Digo “las” porque hay varias clases. En conjunto, hay tantas histonas como ADN en el cromosoma. Varias de ellas se juntan para formar un bloque (nucleosoma) alrededor del cual el ADN da un par de vueltas, como un hilo alrededor de un carrete, antes de seguir hacia delante, hacia el siguiente bloque de histonas, para dar otro par de vueltas y seguir… Pero las histonas no parecen tener sólo un papel estructural. Se cree que pueden influir, y mucho, en cómo son leídos los genes. Tendrían información sobre la información genética. Pero eso es otra historia…

No todas las proteínas de un cromosoma son histonas. También hay de otras clases. Cuando tomas un cromosoma, le rompes el ADN y se lo quitas por completo, y también le quitas las histonas, aún se ve la forma del cromosoma. Porque el ADN se asienta sobre un andamio de proteínas. ¿Adivinarías más o menos la forma del paraguas si le quitaras la tela? Pues igual con el cromosoma dejando sus proteínas.

Cromatina

Luego también me he cargado la segunda afirmación. Que decía…

2º) Un cromosoma no está hecho de ADN. Está hecho de ADN y proteínas.

Y es que el armazón es muy importante porque cada célula tiene unos 2 m de ADN, que tiene que meter en un espacio casi 350.000 veces menor (el diámetro del núcleo es, más o menos, de 6µm). O lo que es lo mismo, meter un hilo de 40 Km dentro de una pelota de tenis y que sobre espacio para poder leerlo. Y, teniendo en cuenta que el genoma humano tiene unos tres mil doscientos millones de letras, siguiendo con las escala de los 40 Km, en cada milímetro de esa pelota de tenis habría 80 letras (llamadas bases) esperando ser leídas para fabricar las proteínas que se necesitaran.

cggatttacaaatggattgattaccagttttaaccccacgacttcaggagtagccctaaagggattccaagccatatatc

Todo eso en un milímetro si el núcleo de la célula tuviera el tamaño de una pelota de tenis.

Ya sólo me queda la tercera.

3º) Un cromosoma no se divide. Se multiplica y se divide. Por dos en los dos casos. Primero se multiplica y luego se divide.

Porque si no, la célula hija se quedaría con la mitad de información de la madre. Lo que ocurre es que los cromosomas que vemos, esos famosos con forma de X, ya están multiplicados por dos. Eso ha pasado antes de que se inice la división celular, la mitosis. En una etapa de la célula que se llama fase S. Durante ese ratito se ha copiado el ADN para dar otro. Teniendo en cuenta que ese proceso de duplicación puede durar unas 6-8 horas, la maquinaria de la célula copia entre unas 110.000 y 150.000 letras (llamadas bases) por segundo.

Así que, duplicados los cromosomas, sólo les queda dividirse en sus dos partes, llamadas cromátidas. Que es lo que tenemos normalmente en nuestro núcleo. Cromátidas. Hasta que la célula decide dividirse, que empezamos a tener cromosomas. Formados por dos cromátidas que están unidas en un punto, el centrómero. A ese punto se fijarán las fibras del citoesqueleto para romper en dos el cromosoma y tirar de cada cromátida hacia un lado. Pero eso es otra historia.

Cromosoma, centrómero y cromátidas

Cromátidas en vez de cromosomas. Dentro de tus células cuando no se están dividiendo. Es lo normal.

La próxima vez que abras un paraguas, recuérdalo.

15 Replies to “En qué se parece un cromosoma a un paraguas”

  1. Adriana Hoyos

    soy docente de biología y preparo a los jóvenes para el exámen preuniversitario. me encantó su página blog. yo estoy empezando a montar la mía pero todavía es muy insípida porque no conozco muy bien como diseñarla, si puede darme algunas instrucciones se lo agradecería
    Adriana.

    Responder
  2. Imagen de perfil de José Luis Castillo

    ¡Hola Adriana!

    Yo no sé cómo hacerlo bien del todo. Me salen todavía post muy largos. Pero sí sé que hay que incluir la mejor imagen posible y tener muy claro qué quieres contar antes de escribir. Y dejarse llevar. A veces, las letras te llevan a un sitio que no esperabas ni tenías intención.

    Saludos y espero que te animes a no dejar de escribir. Es muy útil personalmente. Te afila, te obliga a ser exacta. A mí me ha sido muy útil.

    Responder
  3. María Miguel

    Acabo de descubrir tu blog y parce que está bastante bien, pero tengo algunas discrepancias con este artículo.
    Si tomas al cromosoma como una mera estructura de empaquetamiento si es cierto que podría decirse que “no se encuentran en el núcleo”. Pero cuando uno hace referencia al locus de un gen se refiere al cromosoma y la banda en la que se encuentra. Es decir, aún cuando no son visibles como la típica estructura en x a la que te refieres están ahí; en mi opinión son, más que una forma de empaquetamiento, los fragmentos en que se divide el ADN (23 pares en lo que se refiere al hombre).
    Un claro ejemplo, a mi modo de ver, de que los cromosomas no son sólo un empaquetamiento es el uso del término para las bacterias (el cromosoma bacteriano, se dice que es uno porque todo el ADN de una bacteria está en un sólo fragmento); y su uso para los cromosomas politécnicos de Drosophila melanogaster que nunca participan en divisiones (le resulta algo imposible por su gran número de cromátidas).

    Un saludo.

    Responder
    • Imagen de perfil de José Luis Castillo

      ¡Hola María!

      Cuando mencionas el cromosoma bacteriano llevas toda la razón. Porque es una estructura fundamentalmente dinámica. No estoy del todo de acuerdo cuando indicas que un cromosoma tiene genes. A ver si me explico, que es una cuestión de funcionamiento y un poco filosófica, y puede confundir a los alumnos (por culpa mía). Yo no creo que el gen sea un lugar en el cromosoma, sino una actividad determinada en un lugar determinado del cromosoma. Que sería la manera de evitar el problema que plantea la superposición de genes. Y, durante el empaquetamiento en eucariotas, la actividad génica desaparece. En ese sentido, y no en otro, el cromosoma es una estructura dirigida, fundamentalmente, al empaquetamiento. Pero también al traslado, al movimiento, al cambio de sitio. Sí que es una entidad activa, pero no es una entidad activa desde el punto de vista genético.

      Es una cuestión de puntos de vista. No es en absoluto que lo que dices no sea correcto, para nada. Pero yo quería centrarme en qué le ocurre a la actividad genética cuando toca empaquetarse y repartirse. Y cesa. Por lo que sabemos (por lo que sé yo, por lo que leo), cesa totalmente. En ese sentido, los genes desaparecen. Porque cada vez estoy más convencido que el concepto de gen no es un concepto pasivo, de lugar, sino dinámico, de actividad. Y, por supuesto, tras desaparecer, el gen reaparece. Cuando desaparece el cromosoma.

      Otra cosa es que el gen sea más visible (su lugar) en términos de cromosoma. Pero eso es cuestión del observador, que no es capaz de verlo en actividad (no hay técnicas bien desarrolladas, aún, que yo sepa). Por eso nos limitamos a definir gen como un lugar. Porque es lo que sabemos/podemos hacer. Si supiéramos/pudiéramos verlo en plena actividad, no lo definiríamos así, como banda en el cromosoma. Ese es un concepto temporal, a la espera de otro mejor (que, a lo peor, tarda, todavía, mucho).

      ¡¡¡Un saludo y gracias por comentar y darme la oportunidad de explicarme mejor!!!

      Responder
    • Imagen de perfil de José Luis Castillo

      ¡Hola Jose!

      Pues espero que sí, que a lo largo del curso que viene pueda producir post que os sirvan a quienes visitáis este blog de cuando en cuando. Muchas gracias por comentar.

      ¡Un saludo !

      Responder
  4. Alba

    Hola Jose Luis:

    Buscando información para mi alumnado me he encontrado con tu página. Me ha encantado!. Sobre todo ese lenguaje tan cercano, tan de llegar a la gente profana.
    Además sobre el tema en concreto, me parece que haces un texto un tanto revolucionario, porque estoy harta de encontrar siempre la misma historia sobre la mitosis y los cromosomas y aquí dejas muy clarito que cuando hablamos de cromatina y cromosomas hablamos de lo mismo pero en distinto momento. Genial. No dudes que aprovecharé tu buena explicación.

    Responder
    • Imagen de perfil de José Luis Castillo

      ¡Hola Evelyn!

      El ADN siempre está en forma de cromatina. Lo que ocurre es que a veces se empaqueta más y otras menos. Cuando está muy empaquetado no puede ser leído. Cuando está menos empaquetado sí que puede leerse, fabricar ARN y que ese ARN llegue al citoplasma.

      Espero haber ayudado. ¡Un saludo!

      Responder

Deja un comentario si lo deseas. ¡Y gracias por leer! :)